Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST454075
Clone ID OST454075
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST454075
Sequence
GACTGAGGTGCCTGAGANATCAGCTCCATCCGGCAGGCCGGGAAGATTGCCCGCCAGGAAGAGCTGCGTTGCCCCTCCGA
GTTCGACGATACCTTCGCCAAAAAGTTCGAGGTGCTCTTCTGTGGCCGGGTGACTGTGGCTCACAAGAAGGCCCCACCCG
CACTGATTGACGAGTGTATCGAGAAGTTCAACCATGTGAGCTGTGGTCGCAGAACGGACTGGGAAGCGCCCACCGGGCAG
CCATCAGCGCCTGGCCCCAGGCCCATGCGCAAATCCTTCTCACAGCCTGGACTGCGCTCGCTGGCCTTCAGGAAGGAGTT
CCAGGACGCTAGCCTCCGCAGTAGCACCTTTAGCTCCTTTGACAATGACATAGAGAACCACCTCATCGGTGGGCACAATG
TGGTTCAGCCCACAGACATGGAGGAGAACCGAACTATGCTGTTCACGGTAAAATCTGTCGGTTTTTTGCAGCTTGAGGTC
TGAAAAATCTGTCTTACACATCCATGTTTGAG
Sequence Type mRNA
Unitrap ID UNI16784

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 64647952..64648457 500
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029174 (Tbc1d1) NM_019636 TBC1 domain family, member 1 Gene [Source:MGI (curated);Acc:Tbc1d1-002]

 
Come back to gene ENSMUSG00000029174


For any suggestions or comments, please send an email to unitrap@crg.es