Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10106G3
Clone ID IST10106G3
Vector VICTR76
Project tigm

Sequence tag IST10106G3BBR1
Sequence
GTGAGCTTTGCTTACATCCTTCTGGTCTTCATTTCCGGCCTACTTTGCTTCCACGTGTGAAGTCCATGGGATGTGGGATT
CACTGCTTAGCCATTATTATTTCTTCCGTGGATAGGAGGCACATCCTCTTGGCTGCACAGCCATTCCCACCTCCACATCC
AGAACCTCCCATCCTCCGCATACGAATCTCTGAGCCCATTTAACATTAACTCCATCCCTCCTACCCACCACCCCACAGTA
GGCCCGATAGCTCTAGGAACCCCTCGGGAATGAGATGCTGCAGTGTGCATCCTCTGTGTGAGTTTCCCAGCAGTGAGAAT
CCTGTCCCCAAAGTCCTTTCACTTATTGAACTTTGTGTCAGAGTTCTCTGTTTTCAAGGCTGCATAATATCCTAGTGTAT
AGACATCACACTTCACTTATGCAGCAGCACTGGGCACTTGGAGCTGCCTGTCTCCTGTTGTGTGGACAGTGCCAGGGTGG
ATACAGATGAATGGTTTTCCCTTTAAGATCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57004111..57004620 508
 
EST/CDNA Est Name
  BB617218.1


Sequence tag IST10106G3HMF1
Sequence
CTCACTATACCCCAATCTCAGGCTCGGTAGTGGCTCTCCACTTCGTGCAGCTGCTTCTCCATTTTTCTCAACTCCTAATG
GTCAGATCTTGAGTGAGCACGCCCGAGAACTGATGCATCTTTCTTGTGGTTCTGTTCCTTCCAGCTCGGCCTGCAGCGCT
TCCAGTGTGTCGGCATCCTGGGCTTTAACTCGGTCGAGTGGGTCGTTACTGCTCTGGGCACTATCTTGGCTGGGTATGTT
CTACCCTTTGGTTNACTGTGTTA
Sequence Type genomic DNA
Unitrap ID UNI31421

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57003854..57004115 260
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024207 (Acsbg2) NM_001039114 acyl-CoA synthetase bubblegum family member 2 Gene [Source:MGI (curated);Acc:Acsbg2-001]


Sequence tag IST10106G3BBF1
Sequence
CTCACTATACCCCAATCTCATGCTCGGTAGTGGCTCTCTACTACGTGCAGCTGCTTCTCCATTTTTCTCAACTCCTAATG
GTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI32092

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57004027..57004115 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024207 (Acsbg2) NM_001039114 acyl-CoA synthetase bubblegum family member 2 Gene [Source:MGI (curated);Acc:Acsbg2-001]

 
Come back to gene ENSMUSG00000024207


For any suggestions or comments, please send an email to unitrap@crg.es