Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14932C7
Clone ID IST14932C7
Vector VICTR76
Project tigm

Sequence tag IST14932C7HMF2
Sequence
ACTTCTCCACACTTGGTCCTTTCTAAGTCACCGGGAATCCAGACTCTGGCTCCTCCCTCAGGCTACATATCTCGAGATGC
TTCTCTTTGGTCCTCTGCCCAGGCACTCAAGGCCACCATATCCTGATGGGACAGAAGACTACCTTCGGGGCCCTGCCNAN
ACCCATCATCANGGAGGGTGGGGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 141721370..141721554 179
NO GENE  


Sequence tag IST14932C7BBF1
Sequence
GTATCTCTCACCACAGTGAGCCACATTCTGGGCCACAAAACAAAACTTAGCAAATTCAACCAACACTGATATACATGGTG
TTTGTTTGTTTGGTTGGTTGGTTTTGGTTTTTTGAGACAGGGTTTCTCTGTATAGCCTTGGCTATCCTANATAGAACTCA
CTTTGTANACCAGGCTGGCCACGAACTCANAAATCTGCCTGCCTCTGCCTCCCAAGTGCTGGGATAAAGGCATGCGCCAC
CNCACCCANCGGTATACATGTTTTTAATCCCANCNCTTGGGANACAGTGACAGGTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102198029..102198328 284
 
EST/CDNA Est Name
  BF456321.1


Sequence tag IST14932C7HMR1
Sequence
AGTCNGAGCGGGTCCCTTAGCGACTGAGGGGCTAGAGGTANAGTGGCCCTTGANAGCATTTTGCAACAAAAGGAAAAAGA
AATATGGAATTTGCTAGAAGGGAAAGGGTTGANACAGGGTTC
Sequence Type genomic DNA
Unitrap ID UNI30040

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 141721252..141721372 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040606 (9030409G11Rik) NP_001103155 RIKEN cDNA 9030409G11 gene Gene [Source:MGI Symbol;Acc:MGI:1918779]

 
Come back to gene ENSMUSG00000040606


For any suggestions or comments, please send an email to unitrap@crg.es