Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10398E9
Clone ID IST10398E9
Vector VICTR76
Project tigm

Sequence tag IST10398E9HMF1
Sequence
GATCAAGTCCTTGGAGGAGATCTACCTGTTCTCCCTGCCCATTAAGGAGTCTGAGATCATTGATTTCTTCCTGGGTGCGT
CCCTAAAGGATGAGGTTCTGAAAATCATGCCAGTGCAGAAGCAGACTCGGGCTGGA
Sequence Type genomic DNA
Unitrap ID UNI12386

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 61419260..61419394 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069367 (AC121903.2)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24857523..24857657 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044533 (Rps2) NM_008503 ribosomal protein S2 Gene [Source:MGI Symbol;Acc:MGI:105110]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 26955308..26955442 135
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 76091805..76091939 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061833 (AC122242.2)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 60182227..60182361 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066487 (AC153654.4)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96714410..96714544 135
 
EST/CDNA Est Name
  CK022030.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 63859829..63859963 135
 
EST/CDNA Est Name
  CK022030.1 - CB209298.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122646240..122646374 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083891 (AC131715.3)  

 
Come back to gene ENSMUSG00000083891


For any suggestions or comments, please send an email to unitrap@crg.es