Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XT0589
Clone ID XT0589
Vector pGT0lxf
Project sanger

Sequence tag XT0589
Sequence
CCACATTTTGTTTCAGTGCTGTGATCTTCTATCTAGGAAATTCTAGGTTTGTGATGGAGAAATACACAGCTCTTTTTTTC
TAAGACAAAACATCTGCTAGTTTATTTTTACAATTTTGTTACATTAAGCCTGAGGAAAAGCAAGCTAAAAGGATTTTTAT
TCCTTTTAGTAGCAACCAAACTTTGATAGTAATGACTTTTTTTTAATATACTGTATTTTTTTAAGAACAAAGTTAAAACT
TAAAAAGAGGCTGAGGATGGAAGGAACTTCTTTGTTCTATCTTCTTCAGAATGTTAGAAGTCTTAAGAACTCAGGACAAG
CAGCAGACATACATGCAACATGGTGACTG
Sequence Type genomic DNA
Unitrap ID UNI1404

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108420809..108421157 349
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006673 (Qrich1) NP_001107591 glutamine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1916482]

 
Come back to gene ENSMUSG00000006673


For any suggestions or comments, please send an email to unitrap@crg.es