Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST453999
Clone ID OST453999
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST453999
Sequence
GACTGAGGGACCCAGAATGGAGCTTCGANAGAAGCTTGGTCTCCGGGGCCACTGGATTCTGAGGACCAGCAGATGGCCAG
TCATGAGAACCCAGCATTATTAGGTTGAAAAACTCACCTGTGGGTTACGTGGAGCCTAGGTGTTTTGGGTAAGACCCATN
CTGGTCCACCAACACCCTCCTCCCTCTCCCTGGTGATTCCAGCCTGATGACAAGAAAGCTCATGCGAAGGCACAGTGGGC
CAAGTTGTGTGTCTGACACCTGGAGCAGACGGCATTGGCTTTCTCCATGTTAATAAATTGGTGCTTACAACACANNGAAT
AAAANGATCANTACATTTNGGTGCCATNNCCCNNTGTNGTTGCAANATTACCNTGTACACTNCCACANACNNGTTCTGGG
NGNGATNAAGNATGAGGGAGGGACATGGGCTGGGGAAT
Sequence Type mRNA
Unitrap ID UNI16792

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 6093927..6094754 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046792 (Zfp787) NM_001013012 zinc finger protein 787 Gene [Source:MGI Symbol;Acc:MGI:1914359]

 
Come back to gene ENSMUSG00000046792


For any suggestions or comments, please send an email to unitrap@crg.es