Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11585G11
Clone ID IST11585G11
Vector VICTR76
Project tigm

Sequence tag IST11585G11BBF1
Sequence
CTGAGGTCCTGAGTTCAAGTCCCANTAACCACATGGTAGCTCAAAACCATCTGTAATGGGATTCAATGTCCTCTTCTGGT
ATGTCTGCANATAGTAACGTGTTCTCATATACATAAAATAAATAATTTAAAAAGAAAAAAAAATTAAAAGAGAAAAAGTT
GATTACNCNTNNTNNGTACTCTNNATGACTTTTTACNTTANNGANAAAANCANTGGAATAAAAGTAATANTTGAGTTTCT
GATCTGANTAACTAATANCATGGTGATGCAAACTGCAAAGGCNNCANCNNTGTGNCCNNGATGAAACAATAGCCTTATTA
ACAAAATTANGCAACACTGCCCATGACTTCTTACCACTATATTTACCACTGTGCCNTATTCAGTCTTGGGACTCANATCT
G
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11585G11HMF1
Sequence
CTGAGGTCCTGAGTTCAAGTCCCANTAACCACATGGTAGCTCAAAACCATCTGTAATGGGATTCAATGTCCTCTTCTGGT
ATGTCTGCAGATAGTAACGTGTTCTCATATACATAAAATAAATAATTTAAAAAGAAAAAAAAATTAAAAGAGAAAAAGTT
GATTACNCATANTAGGTACTCTCGATGACTTTTTACATTAATGAAAAAAGCAATGGAATAAAAGTAATAATTGANTTTCT
GATCTGANTAACTAATANCNTGGTGATGCAAACTGCAAAGGCNNCNNCNNTGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11585G11HMR1
Sequence
TTAACTGCTGAGCCNTTTTTCCAGCCCTCTTTTAATTTTTC
Sequence Type genomic DNA
Unitrap ID UNI10851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70328283..70328323 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]

 
Come back to gene ENSMUSG00000032217


For any suggestions or comments, please send an email to unitrap@crg.es