Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14521C2
Clone ID IST14521C2
Vector VICTR74
Project tigm

Sequence tag IST14521C2BBF1
Sequence
GATGAACAAAGCTATAAGCATAAACCAAATAAACCCCTTCCTCTTCTACTTGCTCACTGGTCATGGTGTTCATCACAGCA
ATAGTAATCCTCTCTAAGAGAGATGGAGAATGGAGAACCTCAGAGGTTTAGAAAGGCAAAAGTCAGTGAGGACAATAAGT
CACAATGGTTGGAGTCGAGAAAAGCCACTTTAAATTTTCAATAGCGTAGGTTACTCAGAAGTACATGCAGTGGATTTACC
ACTGCAGCAGAAATATGGAAAAGAATATGATCAAAATATATAGTATATGAAAATTTTTTGAATAGAACGTGAAGCAGAAA
TAGGAAGACTTATTTAAGCCTTCTTTCTNACTATTCTTTANGGGGGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108533582..108533951 364
 
EST/CDNA Est Name
  CJ224426.1 - BY573247.1 - BB733447.1 - W53802.1 - BF143331.1 - CO045335.1 - CD540381.1 - CO802647.1 - CD540516.1 - CK342121.1 - AW761857.1 - BM730702.1 - BM876889.1 - BE950747.1


Sequence tag IST14521C2HMR1
Sequence
ATNNTCAAAAGAAGCCAGGNCAGCAACTGAAACAGGGCAGGAACCTGGAGGCCAGAGCTGATGCAGAGGCCATGGAGGGG
CGCTGCTTACTGGTTTGTTCTCCATGGCTTGCTCAACCTGCTTTCTTATGGAACTCAGGTCCACCAGCCCAAGGGTGACC
CCACCCACAATGGGCTAANCCTTTCCCTTTCAGTCACTAATTAAGAAAATGCCNNATCTTATGGAACCNTTTTCTTGATT
AAGATTCCCTACTTTCAGATAACTCTAGTTTTTAATGTCNAGTN
Sequence Type genomic DNA
Unitrap ID UNI1144

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108533302..108533580 267
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064145 (Arih2) NM_011790 ariadne homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1344361]

 
Come back to gene ENSMUSG00000064145


For any suggestions or comments, please send an email to unitrap@crg.es