Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14308B10
Clone ID IST14308B10
Vector VICTR74
Project tigm

Sequence tag IST14308B10BBF1
Sequence
GAATGTCCCCAGCAAACTAAAAAGGTGTATGGCTCAGTGAGAGTCAAGGAATACGTGCTGATTGACTGATAGCTCTTCCA
GTTTTCGGTTCCAATCCACAATGTGGGGATAGTTAGACCCACAGAGGCCATCANAAATAAGCTCTAGCTTATGGAGGTGG
AAAGGTGGGCACGAGAGAGCTATTGGCTTCTTACAGCTTCTGGAAGAAGGAAAGTCAGTTTTCTTTAATGGTGCAATTGA
TCACACCGATCACACTCACNNNCTANCNCNTCANTGANTTANTTCNCCNTNANCCTNNACTCNGGATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14308B10HMR1
Sequence
ATTCCAAACTAAGTCAGGCACAATCACTTTTGTTATTGACTGCAGCCTCTACTGAAGGACTCANAAAATAAATGTAAAAT
AAAGGAATTTCAACTAACAGTGTCTGCTATGAAACTAGCTGATGATGGCATGAAGTCATTGAGAGTGACAATGAGGAGGG
TAAAAGAAGGTCTAAAGAGGTANAAGAAGGTCTTCCTGGGGGTGACATTTGAGCCTACTCCCAAACTGTGAAAGAGCTAC
CCACGAGACAAAAATCTCACATCGTACACNNNTCCAGAGACAGAAATAAGTTGGATAGGATTGAATATCAACAAAGACAA
ACAACAACAAAAAAAACCNGGGTCCGTGTGGAGCGTGCANANCGAGCNGAGTTN
Sequence Type genomic DNA
Unitrap ID UNI31861

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 90497758..90498130 355
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020546 (Stxbp4) NM_011505 syntaxin binding protein 4 Gene [Source:MGI (curated);Acc:Stxbp4-001]

 
Come back to gene ENSMUSG00000020546


For any suggestions or comments, please send an email to unitrap@crg.es