Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14567A8
Clone ID IST14567A8
Vector VICTR74
Project tigm

Sequence tag IST14567A8HMR1
Sequence
ACAAAGTGAGTGCCAGGNCAGCCAGGGCTACACAGANAAACCCTGTCTCAAAAAAAAAAAAAAAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI11537 UNI31529

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29141554..29141627 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024006 (Stk38) NM_134115 serine/threonine kinase 38 Gene [Source:MGI (curated);Acc:Stk38-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 90372410..90372483 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44936761..44936834 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 87992385..87992458 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020061 (Mybpc1) NP_780627 myosin binding protein C, slow-type Gene [Source:MGI (curated);Acc:Mybpc1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16415065..16415138 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 12338739..12338812 70
NO GENE  


Sequence tag IST14567A8BBF2
Sequence
GTAGACCAGGCTGGCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCCGGAGTGCTGGGATTAAAGGCGTGCACCACCAC
GCCCGGCTTCTGTTTTCTTTTTAATTGGTGGTTATTAGGCAGGGGAGGGCTTGTAACCTGGAGGTGTAGACTTATTGGGG
AATAACCTGGAGAGGCAGGTCTTGTTTGGGGGTAGCCTGGGAACTGGAACTAGGTACTGGCCTGTTAGTTTACTTGAGTT
TAAACTTAGGTCAGGTTTTGTTTGTTTGTTTGTTTGTTTGANACAGGGTTTCTNTGTATAACCCTGGCTGTCCNGGAACT
CACTCTGTGAACCANTCNGGCCTTGNNCTCNNANNTCTACCTGCCNCNGCCTCTGNNNCNNANNTGCTGANATTAANGGC
NTGCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020061


For any suggestions or comments, please send an email to unitrap@crg.es