Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12788G8
Clone ID IST12788G8
Vector VICTR76
Project tigm

Sequence tag IST12788G8HMF1
Sequence
TTTTCTGGACAAGACACAGCTAATACATTTGCGATCCCACAGCAGCTGTGACTGTCTGCAGTAGGCCTGCACAAACTGGG
TCTGTCCATGACCCATCATGGACTGTGATGGGACTTGTGGGACCCTACCTCTCCCTACTGAAATAGAGTCTCCTGAGGGA
TGCCAGGGCANAGCACATTCTAAATTCATGGTCACACAGATGGCCCACAATATGCAACTGTGAACTGCAAAAAGGAGAAT
AAGAGGTTGCTTTCATTGAGGAATTGTGTGGGTTATTTTTATGTTAAGTAACTTTTATCCTCACAGTGTAATACTCTAAA
AATACCTGTGCCCTCCATTTTAAATCCCAAATAACAGANGGCTGTAAAGATGGCTAAGTGCTTAANANCATCCACTGTCT
TGCANANGACTTGGGTTTGCCTCCCAGCTCCCATATNNNGGCTNANGATTATCTGNNNAGGAAGTGTTAANCATCCGTTC
NNAAAAAAGAAAAGAAAAAAGTTGATGGCAAANNAAT
Sequence Type genomic DNA
Unitrap ID UNI31033

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44900647..44901157 473
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071856 (Mcc) NP_001078843 mutated in colorectal cancers Gene [Source:MGI Symbol;Acc:MGI:96930]

 
Come back to gene ENSMUSG00000071856


For any suggestions or comments, please send an email to unitrap@crg.es