Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12201B6
Clone ID IST12201B6
Vector VICTR76
Project tigm

Sequence tag IST12201B6BBF1
Sequence
TTTGTACTAACACTGTTTTTGTCTTTATCCAGGTACATTGAGCGGAAAGCTTTTCTGGATCGAGTGGACCACAGGCAGTT
TGAAATTGAGCGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI10744

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114292622..114292718 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es