Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12368C7
Clone ID IST12368C7
Vector VICTR76
Project tigm

Sequence tag IST12368C7BBF1
Sequence
AGAGCAAGGTTATATTTCCACACTAATCTGAGCTACATAGTGTGTGTCCCCCAGAAGTTCCAGGTCTGTGCCCCAATCCT
CGTCTCCACATCTTCTAAATTACCCTGTTGTTCCCATCCCTGCCTTATCTAGTCTCTGTATTCCTACCTCCCTCATTAGC
AGGGGCAGGGATCAGCCACTGCTACCCTACCTTACTGGGGAAGGACCACACCTCTCCAGGGCAGGGACCACTTGTGTCGA
GGGTGAAAAAGAGAAACGTCAGCATAAGACATCCTAGCCCCAGTCGCCACTTCACACTGAAAATGATGCCCACCCCAGAA
GTAATTTATTTTTTATTAAAGTTGGTTTTGACATAAACATGCTCTTCGTTATGTTCATGGGGACCCCACCATCCGAGCAA
TGTGAGGCCNGATGTGGTGTGGGAAGANGAGCGGCATTTANGGATGGGNNGAAAGATGTGGTCCTCATGGGCTGTGGAGT
GANCTTCAAACCTGGGGCAGTCTGGATCNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95479974..95480480 492
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]


Sequence tag IST12368C7HMF1
Sequence
AGAGCAAGGTTATATTTCCACACTAATCTGAGCTACATAGTGTGTGTCA
Sequence Type genomic DNA
Unitrap ID UNI26002

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95480433..95480480 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]

 
Come back to gene ENSMUSG00000015850


For any suggestions or comments, please send an email to unitrap@crg.es