Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14441F12
Clone ID IST14441F12
Vector VICTR74
Project tigm

Sequence tag IST14441F12HMF1
Sequence
ATGCCACGGCGGAAAGACAGGAGTGGGTGGATGGGGGAGCAACCTCATAGAGGCAGGGGAGAGGGGATGGGATGGGANGT
NCCNAGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14441F12HMR1
Sequence
NATTCCCCTATACTGGGGCATCAAGCATCCTCAGGCCCAAGGGCCTCTCCTCCCACTGATGTCCAGCAAGGCTATCCTCT
GTC
Sequence Type genomic DNA
Unitrap ID UNI16295

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 84377931..84378012 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074513 (Arfip1) NM_001081093 ADP-ribosylation factor interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1277120]

 
Come back to gene ENSMUSG00000074513


For any suggestions or comments, please send an email to unitrap@crg.es