Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13804A10
Clone ID IST13804A10
Vector VICTR74
Project tigm

Sequence tag IST13804A10HMF1
Sequence
CTAGTTATTGTGTCTCTGGCTCGGCGCCCGAGTTCGTGTCTCGGGCTGCTCTCCCCGCCCCGGACTGCGTTCCATTCTTC
TCCGCCCGAGCACGCTGAGCGCGCCAGCCTCGGCCACAGCCAAGCCCCGAGGCCACCGTGCGTTTCCCGCGAGGTGCGAG
GACCCCGAATCGGTGTGGGGAGGCGGTGAGGTCACGCTCGGGGGGGGATCACACACGCACTTANGAATCCCAAGGGATTC
NNCTGGAGTGAGCGAACCTCACTCGGACGCGTGGCCNNCC
Sequence Type genomic DNA
Unitrap ID UNI31296

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97561451..97561726 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018537 (Pcgf2) NM_009545 polycomb group ring finger 2 Gene [Source:MGI (curated);Acc:Pcgf2-001]

 
Come back to gene ENSMUSG00000018537


For any suggestions or comments, please send an email to unitrap@crg.es