Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XT0382
Clone ID XT0382
Vector pGT0lxf
Project sanger

Sequence tag XT0382
Sequence
CATCGCTTTGGCCAAGCTCTACATGTACTGCACAGACCCTTTCCGGATCCCCTTCGCTGGCAAGGTTGAAGTGTGTTTCT
TTGCCAAGACGGGTACCTTGACCAGTGACAGCCTGGTGGTGCGAGGCGTGGCAGGGCTGAGAGATGGAAAAGAGGTGACC
CCAGTGTCCAGCATTCCCATAGAAACACACCGGTTCGTGGCCTGCCTTTCACTCANTCATGCATTTAGTTGTCGGCACCC
TTTTTGGAGACCGTTTTTAAATGTTCCATGCTGACAGCTGTGGACTGGCCACTGCCCAAAGAGGGGAAAGAATTCCTCGG
AAGAATTTTTTTCAGGGCTTAAAATTCTCCAGCGCTTTCATTTTCCCAGTGCCCTAAAGCGAATGTCTGTGCTCGCCTCC
TACGAGAAGCTTGGCTCCACTGACCTCTGCTACATCGCGGCTGTGAAGGGGGCCCCCGAAACCCTGCACTCTATG
Sequence Type mRNA
Unitrap ID UNI3163

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72322601..72323836 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031862 (Atp13a1) NM_133224 ATPase type 13A1 Gene [Source:MGI Symbol;Acc:MGI:2180801]

 
Come back to gene ENSMUSG00000031862


For any suggestions or comments, please send an email to unitrap@crg.es