Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14270F12
Clone ID IST14270F12
Vector VICTR74
Project tigm

Sequence tag IST14270F12HMF1
Sequence
CCCCCACTGTTATAAGTTACTCTTTTGCACTACTGCAGTGGCCAGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7824530..7824575 46
NO GENE  


Sequence tag IST14270F12HMR1
Sequence
GGGGCTCCAGTCNCAGGTAAGGAGAGAATGGTCCCACTTTGAAAATAGAATGGGCTGGATCTGCTAAGGTCTGGAATGTG
AGTATGATGCGGGCCAAAGTTGGTCACAGGGACTAAGGTTTTTGACATGAGTAACTANAAGATCGGATGAGCTGAGAAAC
ATCAAGAAACTGGTAATAGAGAAGGAANTNNAANTCTGCTTTTGAACTGGTTGCACCTATGGGGTTNNTNNANCN
Sequence Type genomic DNA
Unitrap ID UNI9419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7824308..7824533 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031171 (Ftsj1) NM_133991 FtsJ homolog 1 (E. coli) Gene [Source:MGI (curated);Acc:Ftsj1-001]


Sequence tag IST14270F12BBF1
Sequence
CCCCCACTGTTATAAGTTACTCTTTTGCACTACTGCAGTGGCCAGCTCCTCTTGGTGTGTGTGTGTGTCTGCTTCCACCT
CTGCCCCTCACACTGCTCAAGAAGCCTAAGGGATACTTCCTTGGTCTACAACCCTCAGGCTTTCTCCAAGTTTGCACTAT
CAAGGGCAGTGCTGTAACTGACAGCCCTGTTAGCCCCTTCGCTATCAATTCTTTCTGATGATAAGTCAATACAGCCTTTC
CTATCTATTTTATTTCAAATCTCANCAGGTAGTTTTTACTTCCTCAGCCTGTCTTAGTGACTTCCCTACGTGATCTATTA
CCTGTTCTATCTTTTTAAAAAGTTTATCTTTTNANNAAAAATTGTNNGGATGGAGAGATGGCTCANCGGTTAANANCACN
NANTGCTNNTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7824530..7824936 381
 
EST/CDNA Est Name
  W15847.1 - BU560453.1 - AA919192.1 - BE380198.1 - AW231045.1 - DV552674.1 - BG100055.1 - BU506300.1 - CB204564.1

 
Come back to gene W15847.1 - BU560453.1 - AA919192.1 - BE380198.1 - AW231045.1 - DV552674.1 - BG100055.1 - BU506300.1 - CB204564.1


For any suggestions or comments, please send an email to unitrap@crg.es