Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12736H12
Clone ID IST12736H12
Vector VICTR76
Project tigm

Sequence tag IST12736H12HMF1
Sequence
GAGAATATGTTCTTTTCTATCTGTGGTTTCTTTAGTTTTGATGTTCCTGACTGCTGTGGAGGN
Sequence Type genomic DNA
Unitrap ID UNI30916

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 18142705..18142766 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039835 (Nhsl1) NM_173390 NHS-like 1 Gene [Source:MGI Symbol;Acc:MGI:106390]


Sequence tag IST12736H12BBF1
Sequence
GNGAATATGTTCTTTTCTATCTGTGGTTTCTTTANTTN
Sequence Type genomic DNA
Unitrap ID UNI30916

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 18142707..18142741 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039835 (Nhsl1) NM_173390 NHS-like 1 Gene [Source:MGI Symbol;Acc:MGI:106390]

 
Come back to gene ENSMUSG00000039835


For any suggestions or comments, please send an email to unitrap@crg.es