Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13042A7
Clone ID IST13042A7
Vector VICTR76
Project tigm

Sequence tag IST13042A7BBF1
Sequence
AGCAGAAAGTGCTGTCATGGTCCGAGTGCCCTCAAGAAATCTGCTCTGGGGCTGGTGAGATGGCTCAGTGGGTAAGAGCA
CCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCATAACGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79548709..79548867 159
NO GENE  


Sequence tag IST13042A7HMF1
Sequence
AGCANAAAGTGCTGTCATGGTCCGAGTGCCCTCANNAAATCTGCTCTGGGGCTGGTGAGATGGCTCANTGGGTAANANCA
CCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCATAACGAGATCTGA
CTCCCTCTTCTGGANTGTCTGAANACAGCTACAATGTACTTACATATAATAAATAAATAAATCTTAAAAAAAAAAAAAAA
AAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79548709..79548950 226
 
EST/CDNA Est Name
  BB274782.1 - BY779521.1 - BE953803.1 - BB641710.1


Sequence tag IST13042A7HMR1
Sequence
TGCTCCCCAGCTGCCCTGATACCCCCCTGGTCGTGATGTGTCCCCTGANTGAAAAAAAGAGTTC
Sequence Type genomic DNA
Unitrap ID UNI8749

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79548650..79548712 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035673 (Sbno2) NM_183426 strawberry notch homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2448490]

 
Come back to gene ENSMUSG00000035673


For any suggestions or comments, please send an email to unitrap@crg.es