Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14055F4
Clone ID IST14055F4
Vector VICTR74
Project tigm

Sequence tag IST14055F4BBF1
Sequence
AGAGGGCTGGCGCTGCCTGTACCTGCCATCTTAGCACCGTTGACAAACTCACTAGACTCCTACGTCCTGAGCATCCTGGT
CCCAGGGAGCTCACAGTCTGAGGAGGGAAGTGGCCAGAACAGCAAGCCACAAGACATACTTGACACTGTGACATGGTGTT
GCAGAGAAGGTCCTTTAGTTCCCACTGCAGCTTTATCTAATTTTCTTTTTAGGGGTGTGTGTGTGTGTGTGTGTGTGTGT
GTN
Sequence Type genomic DNA
Unitrap ID UNI31623

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 78789814..78790055 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001123 (Lgals9) NM_010708 lectin, galactose binding, soluble 9 Gene [Source:MGI (curated);Acc:Lgals9-001]


Sequence tag IST14055F4HMF1
Sequence
AGAGGGCTGGCGCTGCCTGTACCTGCCATCTTAGCACCGTTGACAAACTCACTAGACTCCTACGTCCTGAGCATCCTGGT
CCCAGGGAGCTCACAGTCTGAGGAGGGAAGTGGCCAGC
Sequence Type genomic DNA
Unitrap ID UNI31623

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 78789939..78790055 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001123 (Lgals9) NM_010708 lectin, galactose binding, soluble 9 Gene [Source:MGI (curated);Acc:Lgals9-001]

 
Come back to gene ENSMUSG00000001123


For any suggestions or comments, please send an email to unitrap@crg.es