Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14445B10
Clone ID IST14445B10
Vector VICTR74
Project tigm

Sequence tag IST14445B10HMF1
Sequence
TCAGTCATCTCTCCAGCCCTGCTTTATTCACTTATTGTGGGGAGGTGAGCGCCTGGAGGTCAGAGGACGGCTCGCGACAA
CAACGTGGGCCCTGGGAATTGAACTCCGTCGCCAGACTTGGCAGCAAGCACCTTTAGCTCACTGAGCCATCTCANCNNAC
CCNANCCCTTTTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104174231..104174404 164
NO GENE  


Sequence tag IST14445B10BBF1
Sequence
TCAGTCATCTCTCCAGCCCTGCTTTATTCACTTATTGTGGGGAGGTGAGCGCCTGGAGGTCAGAGGACGGCTCGCGACAA
CAACGTGGGCCCTGGGAATTGAACTCCGTCGCCAGACTTGGCAGCAAGCACCTTTAGCTCACTGAGCCATCTCACCAGAC
CCAAGCCCTTTTTAAAAATCTCAGGATGAGGGCTGGTGAGATGGCTCAGTGGGTANNAGCACCCGACTGCTCTTCCGAAG
GTCTGAAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAACAAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104174105..104174404 296
NO GENE  


Sequence tag IST14445B10HMR1
Sequence
ACTGAGAAGTCNAGGGCCCTTGCTCTTAGCAAGAGTTCTGTCCCCAGCACCCACTGCAAGCTGCTCACACCTGCTTGTTN
AGCTCCATGTCACCTTACCCTTTCTCCTGACCTTCTCAGGCATCCATACACAACCACACAGAGAGAGAGAAAGAGAGAGA
GAGAGAGAGAGCGCCTGAGACGGCTCAACAGTTAANGGCACTGGCCNNCT
Sequence Type genomic DNA
Unitrap ID UNI30920

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104174400..104174605 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es