Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14822C8
Clone ID IST14822C8
Vector VICTR76
Project tigm

Sequence tag IST14822C8BBF1
Sequence
GTTATTCCTATCTATGTTCAGTGCAGTCATTCCTCAGTGACCCAAAGAACTGTCCCCAGGGTCTAGGAAGGGAACCCCAG
GTACAAAAATACAAATGACATAGGTTTTGTAAATAACCTATGTAAGAAACCCTCTTGCACCTTTGAAACACGTCTATAAT
CCATAATGTGTAAGTGGTATATAAACAGTTGTACTGTGTTATTTAGGAAGTAATGGAAAAGGTCTAATATACTCATTCAG
TCTAAGCTCCACCCCACAGTTACCTGGCAACAGCAGGTGCCTGACTCACTGTAACAGGGGCTGCTCTGCTCTCTCTAGCT
CTTGCCTTCTTGCTCCTACTCTGTCGGCTCGCCCCCTTCCCTCCTCCCTTCCTCCTCGTGCTCATGGGGCTGGCCTCTAC
TCTTCTCTCTCAGTCTCTCTTTCTCTGTCTCNACCACCCTCTNAGCTTCCCTTGCCATGCCCTGAANAATCTCTANNNNA
NNCTATGTGTGGCTGGTCCCNNNNGGGCANGGATGACTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 133212777..133213295 487
NO GENE  


Sequence tag IST14822C8HMR1
Sequence
NNCCAATTAAAATAAGCCAAACTACCCTGGTGCCTATATCCGGCCTTTACCAAGGNANAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI35960

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 31420199..31420260 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062077 (Trim54) NM_021447 tripartite motif-containing 54 Gene [Source:MGI (curated);Acc:Trim54-001]


Sequence tag IST14822C8HMF1
Sequence
GTGTAGCCAATAACCTTTTTAGACATTGGTTGGTTTGTATAGGGTGACTCTCATTTTGTCTGTCCTTGAGGTTTTTAGTG
TGAGGCGGGACAGGGGGGATTGTTAAACTTGTTCTGGAAGCTTAGTAATTTTGACCGTTAAAACTATATTTCTATATTTG
TTTAGTCAGCCAGCTTTTTATCTGCCTCTGTACTTGGCCTGCTAGTACAGTCTGGAAAGTCCTTTTGAAGGGGGAAGGTC
TGGGGTAGTCTTGAATTTATATTGAATATTACAGAATTACAGGTANACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 31419912..31420199 286
NO GENE  

 
Come back to gene ENSMUSG00000062077


For any suggestions or comments, please send an email to unitrap@crg.es