Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15003H5
Clone ID IST15003H5
Vector VICTR78
Project tigm

Sequence tag IST15003H5BBF1
Sequence
TGACTATACTAGAAAGCATGGGAGGGGTGAAGACTCAGACACTAACACACACACACNCACACACNCNCNCACACACACNC
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15003H5HMR1
Sequence
GTCNGGTCGCTGTTGGCCTTGTTGCTCATCTCTCTCTGGATGCTTGGGGCCNGCATGGCCTCTTTGTCTTCANAATCAGG
GCACAGAGAAAGAGCTCAGCAGGTACTCTGGAAAGAATAGCTGCTCATCTTAGGCTTTGCAGTGCATTGTAAAGGTAGAG
ATGGGAGCTATTTTGGGCGGTTTTCAGCCAAGAGGAGATTCAGGANANCAGGCGCAAGAANCATTCTTTTGACCTCTANC
CTGGCANCCTTTGTATCATCCTTGAAATTGGAACCCTCGGTAGGTTTTACTGTGGAAGGGTGACTCAGCAGGAAGAATGA
NTGANCCANGGTTTTGACTTTTN
Sequence Type genomic DNA
Unitrap ID UNI8198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59471995..59472336 320
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]


Sequence tag IST15003H5HMF1
Sequence
CTGACTATACTAGAAAGCATGGGAGGGGTGAAGACTCANACACTAACACACACACACACACACACACACACACACNCACA
CNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59471919..59471999 77
NO GENE  

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es