Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14582B11
Clone ID IST14582B11
Vector VICTR74
Project tigm

Sequence tag IST14582B11BBF1
Sequence
GGCTTTCTGGGANNACACTCGCCTCCNNNNNGAAGAGGGTGAACTTGACAGCACAGCCGTAGCACCTGCTCTCCATAGCA
NNNNNNGGCGCTGCAGAANNGNTAGGTTAGCCTCTCACCAGCGCAGGGTAGGCCTCTCAGACCCTCAGGTTGTGCAGCCC
AGTCCCACACGCCCATCGGCGCTGTCCAGGGGCGGCCCAGCGCGGAGAATTCTGACTTTGCACTCACCAAGGCGGGGCGG
CAGCGGAGTGGGGCATGCTGGGAGTCGTAGTTCATTCTCCGCAGCGCGCTCCTCCACAGCCAGTCNGACGAGAATCGGAA
GGCATCATCCCANGNNGCTNANCGCGCTTTNGGGCCGGCTCGGANCGAGTAAGCCCCGCGCCCACGCACANNCTCAGACT
CNTGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14582B11HMF1
Sequence
NGCTTTCTGGGANTACACTCNCCTCCTTCTTGAANAGGGTGAACTTGACNNCNNAGCCGTAGCACCTGCTCTCCATAACA
NTTCTCGGCGCTGCANAATTGGTANGTTANCCTCTCACCANCGCANGGTAGGCCTCTCANACCCTCANGTTGTGCANCCC
ANTCCCACACGCCNNNCNGCGCTGTCCAGGGGCGGCCCANCGCGGAGAATTCTGACTTTGCACTCACCANNGNNGGGCGG
CNNNNNANTGGGGCATGCTGGGAGTCNTANTTNATTCTCNNCNNCGCGCTCCTCCACAGCCAGTCNNACGANAATCGGAA
GGCATCATCCNNNGAGGCTTANNGCGCTTTTGGGCCGGCTCGGANCGAGTAANCCCCGCGCCCNCGCACACGCTCANACT
CCTGGNAGTTGTANTATCAATTCNAGTTTGGACTNNNACNNTGGCNGTGACCNNAGANCTCTTACNAATGGATCTGTNCN
CNCTGCTCGGCNTTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14582B11HMR1
Sequence
AGCCGAAGGGCCNAGGGAGGACGCGGGGCGAAGGGAAGGGAGTTGCAGGCTAAAGACCGTTTGACGGCTTCTTTTCAGTT
GTGTGGTTTTGATGAAGTAACCCGGTTC
Sequence Type genomic DNA
Unitrap ID UNI35963

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119034938..119035044 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068580 (Zfyve19) NM_028054 zinc finger, FYVE domain containing 19 Gene [Source:MGI (curated);Acc:Zfyve19-002]

 
Come back to gene ENSMUSG00000068580


For any suggestions or comments, please send an email to unitrap@crg.es