Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10836B6
Clone ID IST10836B6
Vector VICTR76
Project tigm

Sequence tag IST10836B6HMF1
Sequence
TTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTCCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTT
CTTTCTTTCTTTCTTATTAC

Sequence Type genomic DNA
Unitrap ID UNI14535 UNI31760

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 7304872..7304965 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 110662251..110662344 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074968 (Tmem16c) NP_001075025 anoctamin 3 Gene [Source:MGI (curated);Acc:Tmem16c-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 47484874..47484967 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032076 (Cadm1) NM_207675 cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Cadm1-001]


Sequence tag IST10836B6HMR1
Sequence
TTCAGACATATGATTCTTCTAGTACTATTGACTATCGAATTTTGATCATGAAGGCACATTGGATTTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3006313..3006379 65
NO GENE  


Sequence tag IST10836B6BBF1
Sequence
TTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTCCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTT
CTTTCTTTCTTTCTTATTAC
Sequence Type genomic DNA
Unitrap ID UNI14535 UNI31760

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 7304872..7304965 94
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 47484874..47484967 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032076 (Cadm1) NM_207675 cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Cadm1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 110662251..110662344 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074968 (Tmem16c) NP_001075025 anoctamin 3 Gene [Source:MGI (curated);Acc:Tmem16c-002]

 
Come back to gene ENSMUSG00000074968


For any suggestions or comments, please send an email to unitrap@crg.es