Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14948G9
Clone ID IST14948G9
Vector VICTR76
Project tigm

Sequence tag IST14948G9BBF1
Sequence
CTTTATAGACGTAGCCCTAGTATCAAGGACCAACAGATAGCAGACATGAATTTATTTTTTTAATCCAACAATCAGGGTGT
TTATTACATCCATTTCCATTAAAAGAATTACAAAGAAAACAATATACAAGACCTGGAAGTGTTGAAGACTTGCCTACCAT
ACAAATGAGATTTTAAACNCAAATAACACAAATCAAGGGAAACTGTTATCCCTANAAAATANTCNNAGGACTTATATTGA
TGGATATGGACACTACAACAGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32628950..32629211 252
 
EST/CDNA Est Name
  AW488022.1


Sequence tag IST14948G9HMR1
Sequence
TAAAGGAAGTATCGGCTTTATGATGGAATGAAGTGAAATTAGATATGGACCATTATTTTAGCCGTGAGTGGGAAACACTA
ANNAGGTGGCTAATTACACCCAAGCGTGAAGTTN
Sequence Type genomic DNA
Unitrap ID UNI2886

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32628842..32628954 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014496 (Ankrd28) NM_001024604 ankyrin repeat domain 28 Gene [Source:MGI Symbol;Acc:MGI:2145661]


Sequence tag IST14948G9HMF1
Sequence
TTTTATAGACGTAGCCCTAGTATCAAGGACCAACAGATAGCAGACATGAATTTATTTTTTTAATCCAACAATCAGGGTGT
TTATTACATCCATTTCCATTAAAAGAATTACAAAGAAAACAATATACAAGACCTGGAAGTGTTGAAGACTTGCCTACCAT
ACAAATGAGATTTTAAACACAAATAACACAAATCAAGGGAAACTGTTATCCCTAGAAAATAGTCCAAGGACTTATATTGA
TGGATATGGACACTACAACAGTTAAACTTCCCAAAGTATAAGGTTAGCACAACACTTATTTTTATTTCACACTTACTTAA
ATCCNAAACTCCAGGTTAATGAATGATCACCTCAGANACTAAGGAAGCTGGAATCTACTCAAGCTGACAGAAGTTCANGA
TATGAACCCATCATTTCTAANGCTGTTNNGGCAACNAATGGGANAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32628951..32629395 429
 
EST/CDNA Est Name
  CA870677.1 - CB246055.1 - CJ060744.1 - BB866401.1 - AW488022.1

 
Come back to gene CA870677.1 - CB246055.1 - CJ060744.1 - BB866401.1 - AW488022.1


For any suggestions or comments, please send an email to unitrap@crg.es