Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15061G7
Clone ID IST15061G7
Vector VICTR80
Project tigm

Sequence tag IST15061G7HMF1
Sequence
TAATAATCTGCTAGATCAAAATTTTTACACTGTCTTATTATTAACCAGCCAAACAGGCTTCAAAATGAATTAGTTTTTCA
TCAGAAATCAGAAATGCAGGTGTTTGATAATTTAAGAATTTTAGAAATTTAGCTTTTGTCGCCTGACTGNNNGCACNNNT
NNNNNNGTATTCTACCACCAAGCCTCACCCCAGTCTTCTATCAATTCACTATTCTACTCCTTTTTACTCTTGGTAGGTAC
AACATTTCATACAGGCCAGGCTGATCTCTAACTGCTAGGTAGCCAGGACTGGCTTTGAACTTCTGATCCTTCTACCTCCA
CTTTCTCTAAGTGCTGCAATTATAGGCTCGTGCCACCATTCTTGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 76882076..76882440 341
 
EST/CDNA Est Name
  BG080939.2 - BY266427.1 - BE334625.1 - BY285917.1 - BY030392.1 - BY282573.1 - BY283226.1 - BB638591.1 - BB233265.2 - BY321064.1 - CB237318.1 - AL362910.1 - BB811726.1 - BY064596.1 - BY327294.1 - BY294441.1 - BY333431.1 - BY332546.1 - BB173550.1 - DV062934


Sequence tag IST15061G7HMR1
Sequence
NTATAATGGAGTTGAATCAATGTTGTAACTTTGGCTTTCATCAGTTATAATCAGATAATATCCTACTACTCTGCATGTGT
CTTGTGTAGATCAAATAAATGACAGTTTTTTTTTAAATGCCAANAANTTTGGATTATTTTAATGACAACTAATAATGTTC
Sequence Type genomic DNA
Unitrap ID UNI1043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 76881920..76882077 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037958 (Ccdc55) NM_001012309 coiled-coil domain containing 55 Gene [Source:MGI (curated);Acc:Ccdc55-001]

 
Come back to gene ENSMUSG00000037958


For any suggestions or comments, please send an email to unitrap@crg.es