Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST453625
Clone ID OST453625
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST453625
Sequence
GAGGAACGTGTTTCTGATCTTCTGAATTTCAACCATGTTGTCAAAATGCTTGCAACATTTTCTAAAAGCCACAATCTCCC
ATCCATATCCAGCGTCATATTCTTGGTTAATAAGCAAACACAGATTTTATGGAACTGTGCCAGCAGCCATGTTGCGCAGA
CGAGTTGTCATCACAGGCATTGGCCTAGTGACACCACTTGGCGTTGGGACTCAACCTAGTTTGGGATCGGCTTCTCCGAG
GAGAAAGTGGAATTGTTTCTGTGGTTGGTGATGAGTACAAGAATATCCCTTGCAGTGTAGCTGCTTATGTACCAAGAGGT
CCACATGAAGGTCAGTTTAATGAAGAAAACTTTGTGTCCAAATCAGATGCCAAGTCCATGTCTTCTTCCACCATCATGGC
TGTTGGGGCAGCAGAGTTGGCCCTGAAAGACTCCGGCTGGCATCCGAAACGAGAAGCAGATCAGGTGGCTACTGGCGTTG
CCATTGGCATGGGCATG
Sequence Type mRNA
Unitrap ID UNI16825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 17074820..17075314 490
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021786 (Oxsm) NM_027695 3-oxoacyl-ACP synthase, mitochondrial Gene [Source:MGI (curated);Acc:Oxsm-001]

 
Come back to gene ENSMUSG00000021786


For any suggestions or comments, please send an email to unitrap@crg.es