Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14935G9
Clone ID IST14935G9
Vector VICTR76
Project tigm

Sequence tag IST14935G9BBF1
Sequence
AAGAGCACCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCACCCGTAATGA
GATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62360560..62360645 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53579874..53579959 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 12786696..12786781 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29689757..29689842 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 89323515..89323600 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100744434..100744519 86
NO GENE  


Sequence tag IST14935G9HMR1
Sequence
TTACCCNCTGAGCCNTCTCACCAGCCCGGTCCTTGTTTTCAAATTGGTGGCTGTTGGTAGTTAATTTTCATGGGTCTGTC
TGCTCTCACTATGACCTGAAGAACACTTGACTGTGTTGAGCTGGGACAGAAAGCAGCCAACGTTAAATGTCAGGGTAGCT
GGATTGTATGTCCCTGTTANGGAACGATCCACAGATAATAAATAAAGGTAACTGTANTTTGACAGTCACATANCCTTANT
GGCCTTGAAAAGAAACAAGGAATTCTCAAATGAAGCTTCTCAAAGATTCTATCCCAAAGCCTGGTTAGAAGTTTATTAAA
ACCCCAGGCCATGCATGGTGGTACTCATCTTCATNCNNNNCCTCGGGAAGCANANGCAGCTGGATTTGAGCTCGAGGCCN
NCCTGGTCTACACAGTGAGTTCCANGACAGCCANGGCTACATAGTGAGACNCNGN
Sequence Type genomic DNA
Unitrap ID UNI6070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29689841..29690290 414
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069020 (Urm1) NM_026615 ubiquitin related modifier 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Urm1-001]

 
Come back to gene ENSMUSG00000069020


For any suggestions or comments, please send an email to unitrap@crg.es