Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10664B10
Clone ID IST10664B10
Vector VICTR76
Project tigm

Sequence tag IST10664B10HMF1
Sequence
AGCCTGGTCTACACAGTGAGTTCCAGGACAGCCAAGGTTACACAGAGAAACCA
Sequence Type genomic DNA
Unitrap ID UNI9638 UNI25872 UNI33734 UNI34153

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 47864485..47864536 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025067 (D19Ertd652e) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q9D669]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 64430677..64430728 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4582313..4582364 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81601340..81601391 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022390 (Zc3h7b) NM_001081016 zinc finger CCCH type containing 7B Gene [Source:MGI Symbol;Acc:MGI:1328310]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 17464288..17464339 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98879913..98879964 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020914 (Top2a) NM_011623 topoisomerase (DNA) II alpha Gene [Source:MGI (curated);Acc:Top2a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40570977..40571028 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032024 (9030425E11Rik) NM_133733 RIKEN cDNA 9030425E11 gene Gene [Source:MGI Symbol;Acc:MGI:1918816]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 105578847..105578898 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 52012915..52012966 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30944005..30944056 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92896779..92896830 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 54970909..54970960 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 38962480..38962531 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 39557791..39557842 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 152667059..152667110 50
NO GENE  

 
Come back to gene ENSMUSG00000032024


For any suggestions or comments, please send an email to unitrap@crg.es