Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12295H11
Clone ID IST12295H11
Vector VICTR76
Project tigm

Sequence tag IST12295H11BBF1
Sequence
TTAGCATTGATCAGAGTAAGAANNANACTTAATACACATTACTGTAAAAGGCTGCACTCATATTCGCAAANNGCCCTNNG
TAAANNNGGGATNTTTAAAGGAGCCTANNNCCNNNNAANTACAATCCATGACCTATAAACCCTCTGACNNCNNTGGTTCA
GGGCAGTCCTTCGCATAGACTTCTGGGAAATGTANTTTCTCTCTGCATGACCCCGCTAGACAGGACTCTGCTCTCTGTGC
TTCCGGGTTCATTTTGCATTTGTGATTCTCCAAACTCTGCGGCGTTCTCAAAGTTCGGACAGTGTGGCTTGTTCTTCGCG
CTTAACATGGAGGTTGGTCCCGGGTGCAGCCTANACTTGCAAACCTCATGAACTCTGAGGTTGGGCGGGTCCGGCGTGCA
GGGAGCCGGTGAGGGCTGGGCGGGAGGCGGANANAANCCCACTTGGATGTGCAATGCNGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12295H11HMF1
Sequence
TTAGCATTGATCAGAGTAAGAAGTAAACTTAATACACATTACTGTAAAAGGCTGCACTCATATTCGCAAATTGCCCTTTG
TAAATTTGGGATTTTTAAAGGAGCCTAATTCCAGTTAAATACAATCCATGACCTATAAACCCTCTGACTTCTTTGGTTCA
GGGCAGTCCTTCGCATAGACTTCTGGGAAATGTAGTTTCTCTCTGCATGACCCCGCTAGACAGGACTCTGCTCTCTGTGC
TTCCGGGTTCATTTTGCATTTGTGATTCTCCAAACTCTGCGGCGTTCTCAAAGTTCGGACAGTGTGGCTTGTTCTTCGCG
CTTAACATGGAGGTTGGTCCCGGGTGCAGCCTANACTTGCAAACCTCATGAACTCTGAGGTTGGGCGGGTCCGGCGTGCA
GGGAGCCGGTGAGGGCTGGGCGGGAGGCGGANAGAAGCCCACTTGGATGTGCAATGCAGATCTAGGCTTGGA
Sequence Type genomic DNA
Unitrap ID UNI627

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 67914504..67914972 465
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030446 (Zfp273) NP_938081 zinc finger protein 273 Gene [Source:MGI Symbol;Acc:MGI:3036278]

 
Come back to gene ENSMUSG00000030446


For any suggestions or comments, please send an email to unitrap@crg.es