Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14250H11
Clone ID IST14250H11
Vector VICTR74
Project tigm

Sequence tag IST14250H11HMF1
Sequence
GGCAAAACAGCCATTCTTATGATGCTTGTAAGCCGTTTCCAAACTGCAATTACCTGTTCACTGAGCCCTGGACTTCCGCA
TCTTCACGTGACAGTTTTTAATCTAAACTCTACAGCCACGCCNCATGCGCCTCATTTGTTCAGCTTTGGGGCTGGGTCNN
NTCCNNGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22264819..22264976 156
 
EST/CDNA Est Name
  AW229185.1 - AA003387.1 - BG100391.1 - BY239911.1


Sequence tag IST14250H11HMR1
Sequence
CCTTCCTGTACTAACGTTTTTATTTTCGCAAAAAGTTCACAGGAACACTTAACCNCTAGTTCACAGTTTATTTTTTTGGT
TAGTAAACTCTAAAAGGCCTTTGACGGTTTGGTAGAGAGCATTCTTGGACTTCCATGGTGAACTTGAACCCAAAAAGAGT
AATTTGAACGGATGTAATCTTTTATATACGGAGATGAGTCCCTAAGACAATTTAAAGTTCNNTGTCC
Sequence Type genomic DNA
Unitrap ID UNI2374

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22264594..22264819 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022858 (Sfrs10) NM_009186 splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:106016]

 
Come back to gene ENSMUSG00000022858


For any suggestions or comments, please send an email to unitrap@crg.es