Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14752D4
Clone ID IST14752D4
Vector VICTR76
Project tigm

Sequence tag IST14752D4HMF1
Sequence
CCGGGACCANTGANGANAGCGCGGGCNANTTCNGAAGCCNCGCCATGGTGANCANGGGCCNCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14752D4HMR1
Sequence
NACNAAGGCTGNNNGGNNCNNNGAGGGCANCCNGGTGTGNANANCCNACNGACGANGGCCNTACAATGANATGCATATAT
CTTTTTAANCNNATANATGCNTGAATCAAATGTACATATATTGAGTCACTGCAACATTTGATAATGGAGTCTGAATATTT
CANAAGTCTCCCTCAATGGGGCGTTACTCTTTTAAACTGTTGCTGATGTGACTGACTTANAAAAATATCCACAATGAGCC
AGGATGGTTCAAAGAGTGGAGGTGCTTGCCGTGATGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14752D4BBF1
Sequence
CCGGGACCAGTGAGGAGAGCGCGGGCGAGTTCGGAAGCCGCGCCATGGTGAGCAAGGGCCGCTGTCCCTGCCCGCTGTGG
TGGATCT
Sequence Type genomic DNA
Unitrap ID UNI22464

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72298650..72298735 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043090 (D330038O06Rik) NM_177899 RIKEN cDNA D330038O06 gene Gene [Source:MGI Symbol;Acc:MGI:3584369]

 
Come back to gene ENSMUSG00000043090


For any suggestions or comments, please send an email to unitrap@crg.es