Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST453546
Clone ID OST453546
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST453546
Sequence
TGAGGCACGGGATCCGGGTGATGGNGTTGACCGGACAGGGATGTGGCATGAGGAAGNAACTGTGCCATNAGCCCAGACTT
TCCTGATGCCTGAGGCCATGACCTTTGAAGAAGCTGCTGCCTTGCTGGTCAATTATATCACCGCCTACATGGTTCTCTTT
GACTTCGGCAACCTGAGACCGGGCCACAGCGTCTTGGTACACATGGAATGCAGGTGGCGTGGGCATGGCAGCCCTGCAGT
TGTGCCGCACCGNGGAGAACGTGACAGTGTTTGGAACGGCCTCAGCCAGCAAGCACGAGGTGCTGAAGGAGAACGGGGTC
ACACACCCCATCGACTACCACACGACTGACTATGTGGACGAGATCAAAAAGATCTCCCCCAAAGGAGTAGACATCGTCAT
GGACCCTCTGGGTGGATCAGACACGGNCAAGGGCTACCACCTCCTCAAACCCTGA
Sequence Type mRNA
Unitrap ID UNI16833

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101323534..101324432 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034993 (Vat1) NM_012037 vesicle amine transport protein 1 homolog (T californica) Gene [Source:MGI (curated);Acc:Vat1-001]

 
Come back to gene ENSMUSG00000034993


For any suggestions or comments, please send an email to unitrap@crg.es