Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12719B2
Clone ID IST12719B2
Vector VICTR76
Project tigm

Sequence tag IST12719B2HMF1
Sequence
GTATCTATTTACAAATCTGTACCACTTTGTGCACACATATATACATACATACATTCATAACGTTCCTCCATATCTGTAGG
CTCTGCATCTATGGTTTCACCCAAGCACAGGTCAAAAACACTTAGGGGAAAAAATGAAGTTTGTNNTGNNAATGANNAN
Sequence Type genomic DNA
Unitrap ID UNI15271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20613436..20613590 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


Sequence tag IST12719B2BBF1
Sequence
GTATCTATTTACAAATCTGTACCACTTTGTGCACACATATATACATACATACATTCATAACGTTCCTCCNTATCTGTAGG
CTNNNCNNCC
Sequence Type genomic DNA
Unitrap ID UNI15271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20613436..20613517 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es