Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13202B4
Clone ID IST13202B4
Vector VICTR74
Project tigm

Sequence tag IST13202B4HMR1
Sequence
ATCCTTAGGTTAAATTGTATTTCCACATTTAAGCTCATGCTGATATTTGCTTTACACGTCTCATCTTCCTTTAGCCAGTT
TCACCCTTCCACCTGTTTCCCTCACAGCTCCTCAAACTTCTCTTTTAAAGAATGTATTTATTACATATATGTATGCATGT
ATGTATGTACGTGGGTCGGGTGTGTGATGTGTGTTCACCAATGCAGGAACGGTCAGAGGACAGTTGGAAGGAGCCCATTC
TCTTCCTGCATGTGAATCCCTGGGCTGGAACTCTGTCCATCAG
Sequence Type genomic DNA
Unitrap ID UNI32467

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 6078867..6079149 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015659 (Serac1) NM_177311 serine active site containing 1 Gene [Source:MGI (curated);Acc:Serac1-001]

 
Come back to gene ENSMUSG00000015659


For any suggestions or comments, please send an email to unitrap@crg.es