Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12054F1
Clone ID IST12054F1
Vector VICTR76
Project tigm

Sequence tag IST12054F1HMF1
Sequence
CTACAAACACCGTGAGGAAGATGACAGACAAGGCCGGCCAAACTAGGCGCATGCCCAGTGGGTGGTCGGCGCGAGTTTGC
GCAGTAGTGGGAATTCAAGCCTCAAAGCTTCCCGCCTGCGCACAGTCGGGAGCAGGCCCAACCCACTTTTGAAGGTGACG
CGAACTTCAGCCACATCCGGTCGTCCCTCACTCTCCCCCTTGGGACTCGGAGCCCTCTCCGGGACGATTCCCGCCTCTTC
CGTGTTTTGGTGCNCACGGGCTCTGACAGACGCANCGGCCATTGGCTGTCGGTCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44113801..44114094 290
NO GENE  


Sequence tag IST12054F1BBF1
Sequence
CTACAAACACCGTGAGGAAGATGACAGACAAGGCCGGCCAAACTAGGCGCATGCCCAGTGGGTGGTCGGCGCGAGTTTGC
GCAGTAGTGGGAATTCAAGCCTCAAAGCTTCCCGCCTGCGCACAGTCGGGAGCAGGCCCAACCCACTTTTGAAGGTGACG
CGAACTTCAGCCACATCCGGTCGTCCCTCACTCTCCCCCTTGGGACTCGGAGCCCTCTCCGGGACGATTCCCGCCTCTTC
CGTGTTTTGGTGCGCACGGGCTCTGACAGACGCAGCGGCCATTGGCTGTCGGTCGACTCGAGAGCGGCGATTGGCTGTCG
CTGGTCGTCGCTCAAACGCCTCGGGGTAGATGGTGTGAGGTGGGTGGGGCGCTGGGCAAACCAGCGGCGCTGGCAGGTGA
GTGGANGCTTGCGGCTCCCGTACCTTGNCGGCTAAAGCGGCTCTCTCCGGANCCTGCGGAAGGCCGGNCTTCCTGNNNCC
GCTCGGTGTNGCNTCCGTGCCNGCCCTTANNCTNNGNGCCCTCGGCTNNGGGGTCTCTGCC
Sequence Type genomic DNA
Unitrap ID UNI22590

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44113554..44114094 503
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032119 (Mizf) NM_172162 MBD2-interacting zinc finger Gene [Source:MGI Symbol;Acc:MGI:2429620]

 
Come back to gene ENSMUSG00000032119


For any suggestions or comments, please send an email to unitrap@crg.es