Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11842H10
Clone ID IST11842H10
Vector VICTR76
Project tigm

Sequence tag IST11842H10HMF1
Sequence
ATATGTAAGTACACTGTAGCTGTCTTCAGACACTCCAGAAGAAGGAGTCAGATCTCTGTTACGGATGGTTGTGAGCCACC
ATGTGGTTGCTGGGATTTGAACTCCTGACCTTCGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCAGCCC
TCAAGACAGTTTCTAAGAGCCCCTAATGATAGCACATTTGCATTGCAGGTTCCAGCAATGGTCAGGGTGGGTCAGGGTGA
CTTTCTTTGAATGAACACACCTTGAACCCAGGAAGCGGGTGGGTGGAGGAATGTCGCTATCTGTTTTATGATTAGCATAC
CTTGGAGCACTGAGTTTACTACTCTTTTAGGATCACTTGTAATTTGGAGGCCNGTCAGTGATAGTCTAANATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 130198122..130198515 390
NO GENE  


Sequence tag IST11842H10BBF1
Sequence
ATATGTAAGTACACTGTANCTGTCTTCAGACACTCCAGAAGAAGGAGTCANATCTG
Sequence Type genomic DNA
Unitrap ID UNI1423 UNI6053 UNI30852 UNI35974 UNI35975 UNI35976

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32492063..32492117 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 20979658..20979712 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74764165..74764219 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024068 (Spast) NP_058658 spastin Gene [Source:MGI Symbol;Acc:MGI:1858896]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94776721..94776775 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4458149..4458203 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049148 (Plcxd3) NM_177355 phosphatidylinositol-specific phospholipase C, X domain containing 3 Gene [Source:MGI (curated);Acc:Plcxd3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 66170187..66170241 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 86333921..86333975 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74448881..74448935 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069814 (E130309D14Rik) NM_001013784 RIKEN cDNA E130309D14 gene Gene [Source:MGI Symbol;Acc:MGI:3588240]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70475877..70475931 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 64178091..64178145 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62388849..62388903 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071253 (Slc25a16) NM_175194 solute carrier family 25 (mitochondrial carrier, Graves disease autoantigen), member 16 Gene [Source:MGI (curated);Acc:Slc25a16-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13083246..13083300 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 116209506..116209560 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024104 (D6Wsu116e) NM_026585 Protein FAM21 [Source:UniProtKB/Swiss-Prot;Acc:Q6PGL7]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 120231074..120231128 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 89221321..89221375 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 130198122..130198176 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 94732115..94732169 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 47856636..47856690 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 120454113..120454167 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 55126156..55126210 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025981 (Coq10b) NM_026424 coenzyme Q10 homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915126]

 
Come back to gene ENSMUSG00000025981


For any suggestions or comments, please send an email to unitrap@crg.es