Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10385A4
Clone ID IST10385A4
Vector VICTR76
Project tigm

Sequence tag IST10385A4BBF1
Sequence
CCCTGCTCTACAGACGCCCCTACAGAGTCCCCTGANAGACCTTCAGCCTGCCCATACAGCAGTCACTCAAATACATGACA
GACAGGATTTCTGGTCGACACTCCAGTAGAACAGGTGGAGAGAACATCTGTGTCTGCGTGTCTGTCTGTAACACACACAC
ACACACACACACACACACN
Sequence Type genomic DNA
Unitrap ID UNI30796

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 151917442..151917619 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060257 (Scrt2) scratch homolog 2, zinc finger protein (Drosophila) Gene [Source:MGI (curated);Acc:Scrt2-001]


Sequence tag IST10385A4HMF1
Sequence
CCCTGCTCTACAGACGCCCCTACAGAGTCCCCTGAGAGACCTTCAGCCTGCCCATACAGCAGTCACTCAAATACATGACA
GACAGGATTTCTGGTCA
Sequence Type genomic DNA
Unitrap ID UNI30796

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 151917442..151917537 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060257 (Scrt2) scratch homolog 2, zinc finger protein (Drosophila) Gene [Source:MGI (curated);Acc:Scrt2-001]

 
Come back to gene ENSMUSG00000060257


For any suggestions or comments, please send an email to unitrap@crg.es