Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12381C9
Clone ID IST12381C9
Vector VICTR76
Project tigm

Sequence tag IST12381C9HMF1
Sequence
GTCAAGAGAGGAGACGAAGCGAGGATCCGAACCGCCGAGACACTCCGGGTCTGAGCCAGGACCAGGGACGTGGA
Sequence Type genomic DNA
Unitrap ID UNI35977

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29997912..29997984 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049676 (A230107C01Rik) RIKEN cDNA A230107C01 gene Gene [Source:MGI Symbol;Acc:MGI:2443617]

 
Come back to gene ENSMUSG00000049676


For any suggestions or comments, please send an email to unitrap@crg.es