Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12279B10
Clone ID IST12279B10
Vector VICTR76
Project tigm

Sequence tag IST12279B10BBF1
Sequence
ACTGTTCTTCCNGAGGTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAATGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI17672 UNI35978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 25339952..25340026 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101530660..101530734 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045273 (Cenph) NM_021886 centromere protein H Gene [Source:MGI Symbol;Acc:MGI:1349448]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 65981676..65981750 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 106940473..106940547 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 27961412..27961486 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124965135..124965209 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029392 (Rilpl1) NM_021430 Rab interacting lysosomal protein-like 1 Gene [Source:MGI Symbol;Acc:MGI:1922945]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 130213351..130213425 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 35559984..35560058 73
NO GENE  

 
Come back to gene ENSMUSG00000029392


For any suggestions or comments, please send an email to unitrap@crg.es