Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14648C10
Clone ID IST14648C10
Vector VICTR74
Project tigm

Sequence tag IST14648C10HMF1
Sequence
ACGTGACCCTCCCTCTTATAGCTTTTGCCTTCTTCTTGGCAAAATGCAGCATCCCAGGGGCTCCAGAATCCTGCAGACTG
CCTGTGGCTAGCATGTCAGGGAGACCTACTTTTGTTCCTGCTTTCTTACAACCTGAATGGTACACACAGGGAGGGCCTCC
CAATGAGCTCTGCAGTCACGGTAGAATTGTGATTCTCTGTCCAGAGACCTCAGAAATGACCTAGCCAATACTTGTTGGAG
AGGANAAAGTTTCAAGACAAGCAAGACCAACAGTGCAGACACTGAGACTCAGGCCTTACTGCAGTCTCTTGCACTCTTCA
TCATGCATGGCCTCCCCANANTGCCCCCACCTTANCTAGGTTCCAGANGGTGCTTTCAGCGTANCTCGGCNTTTGCNAAG
CCAAGCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 43570087..43570492 390
 
EST/CDNA Est Name
  CJ124602.1 - CJ118376.1 - CJ122866.1 - CJ110189.1 - CJ116225.1 - CJ118320.1 - CJ119897.1 - AI747903.1 - CJ101891.1 - CJ122783.1 - CJ124074.1 - CJ122410.1 - CJ126890.1 - CJ124145.1 - CJ128659.1 - CJ110183.1 - CJ111192.1 - CJ128508.1 - CJ129705.1 - CJ129556


Sequence tag IST14648C10HMR1
Sequence
NGTGATGGGTCNGAGCAGTGCTCAGAAATCCCAGGAAAGAATGGGAGACAAAGAAAAGGAAAAAACTGACCCCGGAAAAG
TAAAAAAACAAGGCAGAGGCGGGGTTGAGAAAGAGGTGAGCANAAACTAGAGGCCCAAGGCACTTGGAACCAGAGAGGCA
CAAATTCCAGTGGTGCGGGCAGGACAGTGTCCTCAGGTGACACTGCATTTCAGGCCTGCTATTGTACTCTANNNACCANC
TTCTCTCTGGGATGTCTTAAGTGGTCTANACTGGCCCATTTGATGTAAGTNATCTTTCACCTTTTGAAATTATTAAATAN
GACGGACAGCTTACTATTATTTTCTGTCATGGTGACTCCCTTAAAAATCCTCTCTCTGGGACTCTGAGGCACTTCGGTGA
GGGTGTATTCTAATGCTCTGATGCTACTGGCN
Sequence Type genomic DNA
Unitrap ID UNI15182

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 43569659..43570088 412
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028465 (Tln1) NM_011602 talin 1 Gene [Source:MGI (curated);Acc:Tln1-001]

 
Come back to gene ENSMUSG00000028465


For any suggestions or comments, please send an email to unitrap@crg.es