Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13132C8
Clone ID IST13132C8
Vector VICTR74
Project tigm

Sequence tag IST13132C8BBF1
Sequence
CCCACAACNACATTCTTTCTTCTTACTATGCCCTCCTAGGAGGGGAGGGGAGGGGGTCGAGACAGGAGTGTCACCTTGCA
GCTCTGGCTGGCCTGGTGTTCGAACAGCTCTCCCTGCCTCAGCCTTCCAAATGCAGGCATTAAGTGTGTGTCACAATGCC
CTCCCCAGGATCGCTCTCCAGGGAGAAGTANAGCTGGGGCTAANAATCTGCCTCTGGACTCAGCTCTGCTAGGAAAAGCC
TCTCTGCTTGGTCTTGGGTTTNACATTTGATAAATGGAACTGACCCTGACTTACCNAGGCTGCCGAGTANCGTAAATGAA
CACATTTATGTGAGAAAGCGCCGTCTCCATTTTGTGTTACATCCTGGTTGTAACCCTGCAAGANTGATCTANNNCCTCTC
TCTTCCCGTGGCATGGTGGTCTGGCAAGAGCATGATGCACTTGANTGCAAGCCTGCGGGCCACTAACCCCGCCCCCACCC
CTCTTGCCCACAGATGCNGNCATCGGGAGCCGCCTCCTGGCANGTAGCACCNCANNTGCCCNNGGCCNGTGGCTGTNNCC
CAGCNNAN
Sequence Type genomic DNA
Unitrap ID UNI33530

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 107646094..107646655 516
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033685 (Ucp2) NM_011671 uncoupling protein 2 (mitochondrial, proton carrier) Gene [Source:MGI (curated);Acc:Ucp2-001]

 
Come back to gene ENSMUSG00000033685


For any suggestions or comments, please send an email to unitrap@crg.es