Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14544B7
Clone ID IST14544B7
Vector VICTR74
Project tigm

Sequence tag IST14544B7BBF1
Sequence
CTGTGAATAANNNNNCTCAGCTGCTTCCTATCTGGCAGTAAGAAGAACGCAAGCAACTTAAAGTCANNNNNGAACCACAG
AAAGCAAACTCAAAACCAAAGTGAAATACAGACTGAATCAAGAACAAAGAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14544B7HMR1
Sequence
NNGAAGCAGGGTCTCACTGTGTAGTCTGTGGTGGCCTGCGGCCCTCAGGCTCCGGACTTCTTTCTCTCGAGTCCTGGGAT
TACTGGGTGGGGGGTGTCAGCCACAC
Sequence Type genomic DNA
Unitrap ID UNI3186

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 46436931..46437034 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024477 (Pggt1b) NM_172627 protein geranylgeranyltransferase type I, beta subunit Gene [Source:MGI Symbol;Acc:MGI:1917514]

 
Come back to gene ENSMUSG00000024477


For any suggestions or comments, please send an email to unitrap@crg.es