Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10077A11
Clone ID IST10077A11
Vector VICTR75
Project tigm

Sequence tag IST10077A11BBR1
Sequence
GGAGTTTCAATGCTCTGCTGCTGCGTATGCCTGTGCTTAATGTTATATTCATCATTTGGCAACCCTACATTAAAAAACAA
AACAAACAAACAAATAACCAAAACCAACCCTAAATTGCCTCCATTTCAGAGGCCACAAAACCTGGTCTTATACTGCCCCA
TATAAATCACTTGAATTTAATTCAAGAAGTGGGATAAGAGGAGGTGCAGCTGGAGAGATGTCTCAGTGGTTAAGAGCACT
AACTGCTCTTTCAGAAGTCCTGGGTTCAATTCCCAGCACCCATATGGCAGCTCACAACTGGCTGTAACTGCAAGATCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4711048..4711364 313
 
EST/CDNA Est Name
  CN697705.1 - BY266500.1 - CJ068703.1 - BI441257.1 - CF531157.1


Sequence tag IST10077A11HMF1
Sequence
TCCNCTTTCTTACTTTCAAAGTAAACTCATCTTGATCTCATCAGAATGCTTCTGTTGCATAAAGAAATGAGGAAAAGTCA
TTTCCATCTANAGTGGAAAGCTTGCCTTTGTATTTATTGCCACTACACCAGCATTTTCCCCCTTAGTTTTTTAAACAGAC
ATNAAGGTAGCTTTAATGTTGGGANAGGAGTTGGCCTGGGAAGAAGCCCTTTGAGCANGATCTCCACTGTTCTGCATTGC
TCNNATGTGATATATTTGATCAGTGTANTANCTGGGANCTTGGGATAATTTAATAATGGGGGTCGTTAATCTTGCAAGCC
TTTGAGCCCTGAATTTACAACTTTAACTTTACATATCTGCTTACTTTNGCATTANAATNGGGTTGGA
Sequence Type genomic DNA
Unitrap ID UNI12508

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4710664..4711045 358
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009073 (Nf2) NM_010898 neurofibromatosis 2 Gene [Source:MGI (curated);Acc:Nf2-001]


Sequence tag IST10077A11BBF1
Sequence
CTCCAACTTTCTTACTTTCAAAGTAAACTCATCTTGATCTCATCAGAATGCTTCTGTTGCATAAAGAAATGAGGAAAAGT
CATTTCCATCTAGAGTGGAAAGCTTGCCTTTGTATTTATTGCCACTACACCAGCATTTTCCCCCTTAGTTTTTTAAACAG
ACATCAAGGTAGCTTTAATGTTGGGAGTGGAGTTGGCCTGGGAAGAAGCCCTTTGAGCAGGATCTCCACTGTTCTGCATT
GCTCAATGTGATATATTTGATCAGTGTAGTAGCTGGGAGCTTGGGATAATTTAATAATGGGGGTCGTTAATCTTGCAAGC
CTTTGAGCCCTGAATTTTACAACTTTTAACTTTACATATCTGCTTTACTTTTGCATTAAAATTGGGTTGGCCAGTGTTAA
AAGGGCTTGCCGATGCTAGTAGTTGCATTTGCAAGAAGTTAATACAAGACACCATAGTGCTCATCCTGACCTCCCAGGAG
Sequence Type genomic DNA
Unitrap ID UNI12508

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4710576..4711051 458
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009073 (Nf2) NM_010898 neurofibromatosis 2 Gene [Source:MGI (curated);Acc:Nf2-001]

 
Come back to gene ENSMUSG00000009073


For any suggestions or comments, please send an email to unitrap@crg.es