Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10835B12
Clone ID IST10835B12
Vector VICTR76
Project tigm

Sequence tag IST10835B12BBF1
Sequence
NCCCTGGCTGTCCTGGAACTCACTCTGTANACCAGGCTATCCTCAAACTCACANATCCTCTGNCTNTGTCTCCTGANTGC
TGGGCATGTGTTACCATGTTTGGCTTAATCGTTTTTGTTTTGTTTTGTTTTAAATGTACANANACAAGGATGGCCTGTGA
GCTCACCCAGTGTGCTCCTGGGGCTTGNGGAATACCAACAACTGATACATCCCAACCTCTGTCCCACAGCNNANAGCTGG
GTGCTCCNANNCACTGNTCGTTTTACTGNGGGCCNNTGCTGCCTACACTCNTGCATANCCCANACTCATCTTTNTGCTGG
GAAGTCNTGCNCCCCCCTCCTTATGGAGATGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10835B12HMR1
Sequence
GGGCTACACAGAGAAACCCTGTCTTGAAAAAAATAAAAACAAAAACAAACAAAAAAAAGAGACTCAAAACAGGCAGTANC
TCCCGAGGCAGGCTGCAGGCACTCCACAGAGATGAAAGANATGAACACTTCTCTTATGGACATGACATGAGCCAGCTCCT
TCTGTTGGGGAGGAGGAGGTTANAGGAGCTACATGCCTTGTTTGANACANACTTTTTCACTGGGACTTGGAGCTTGCTAA
GTGGGCTAAGCTGG
Sequence Type genomic DNA
Unitrap ID UNI8333

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28405874..28406127 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002250 (Ppard) NM_011145 peroxisome proliferator activator receptor delta Gene [Source:MGI (curated);Acc:Ppard-001]

 
Come back to gene ENSMUSG00000002250


For any suggestions or comments, please send an email to unitrap@crg.es