Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST453244
Clone ID OST453244
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST453244
Sequence
GACTGAGGTGGAAGAAGAAGGTGCCACTTTGGCATGAAGATAGACTCACTTAGACGTCAATCTTTTAAGCTGAGTGCATT
GAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI15072

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18284715..18284791 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022718 (Dgcr8) NM_033324 DiGeorge syndrome critical region gene 8 Gene [Source:MGI (curated);Acc:Dgcr8-002]

 
Come back to gene ENSMUSG00000022718


For any suggestions or comments, please send an email to unitrap@crg.es