Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13102F2
Clone ID IST13102F2
Vector VICTR76
Project tigm

Sequence tag IST13102F2BBF1
Sequence
CAGTGAGAATAGACTAGAGAGTGCACAGTGCCTGGATGTCCCCTATGAGTGTTAACACTGATCAAACTCATTCATTCGCT
CACTCATCAACTCATCAGTTCAACAACTGAACATAACTACTCTGTGCCAGGCACTGAACACGCCACAGAAAGCACTCTGT
GATTTCAGCCAGAGTGCCAATCAGGGAAACAGACCGTAGAGGGTCACCACCAGTAGCACCCACTCAGCCCACACTAAAGC
TGGGTCTGGGTCCTTCTCGTGATGAGAGCTGGGCTCAAGATTGCCACACCTGGTCCTGAATGAGGATCGTCAGGAAGGGA
GAAACATGACTTTGCAAGCCTATATGGTTTAAGAGGCAAGCGGAGAGTCAGACTCATGGTATAAGAACCATCCAGGGCTC
CCAATGTGCTTGCTCCCTANGAGTTACCCCGAACTTGACACTGAGATTTCTGGCTCTGANTCCAGCCCCTACCGGGTCAT
AGTTAGTNNANGGGGCTGAGANCTAGTGGGGACCTCATACATGGCNNGCAGGACNNCTTTANAAATCTGGTGN
Sequence Type genomic DNA
Unitrap ID UNI31852

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4074586..4075136 528
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030428 (Ttyh1) NM_021324 tweety homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Ttyh1-005]


Sequence tag IST13102F2HMF2
Sequence
ATTTNNNCAGTTTAGACNANNNNCNNGCCTTTTAANTTTNNGGCANTANTNCNNCAGAGACTGTATATTCNNACTTAGTA
AAATTAGTCATTTAATANAGTCATAATGATTTTTCTCTTTTCTTCAGTGTGACCAGCCATTCTAACTCAATCTCAGACTG
GTCTAATATTCAGTCCAATGTTAGAGATTCCTATATTCTAAATTACCTAGCAAAGTTAATTCAGAGCACATCCCCCACTT
CCCCTANATCCCTAACCTCAGAAGGATTGCTGGCCTTACAGCTAGTAGAAAAAGCTATTAAAGAGCAATTGGTCACTTAA
TACATTGGTAAAATAGAAGGACCCCCTGACTAACAAATAAAAGGGTCCAGATCCAGTTCTAATTTGGGGTAGAGACTCAG
TTTGTGTTTTTTCNCGAGATGAAGATAGAGCGCAGTGGCTGCCAGATAAATTAATTTGTCAGANAAACACAGATTCTAAA
TCTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000030428


For any suggestions or comments, please send an email to unitrap@crg.es