Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12950D9
Clone ID IST12950D9
Vector VICTR76
Project tigm

Sequence tag IST12950D9HMF2
Sequence
CATTCNACNANCGGNCNNNNNNNANNCACNNNNNNNNNNNNGNGANNGCNCANATNNNAGACTGAAGGTCCACGCACCAC
CCANACGTTACCAAAGGTGACTGGTAATCGATCACAGTGTTTGTTTTGTGACTGGAGCTGTACTACAAATGGCTGAAGCT
TCACTGACCTCCCACAANGCNNNCTTAAGGCTACAACAAGCACAATGACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 104072428..104072578 139
NO GENE  


Sequence tag IST12950D9HMR1
Sequence
GATGGAGTTGTGTTTTTCTTTAATACTGTTTCNTTTGAATAAACAGCAAGCTAGGAATAGCTTTAAAATGGTAGCACTCN
Sequence Type genomic DNA
Unitrap ID UNI35987

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 104072295..104072372 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032560 (Dnajc13) DnaJ (Hsp40) homolog, subfamily C, member 13 Gene [Source:MGI Symbol;Acc:MGI:2676368]

 
Come back to gene ENSMUSG00000032560


For any suggestions or comments, please send an email to unitrap@crg.es