Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14840D6
Clone ID IST14840D6
Vector VICTR76
Project tigm

Sequence tag IST14840D6BBF1
Sequence
TTTCTTTCACTTAGCATGCAAATCGTCTAGCGTAAAAAGAGAGGCTTTAGAAGGAGTCAGAATAAATGACATTCTTGAGG
AGGCCTAACCTTGCAGCACTCCAGTTTATCTTCAGGGCTGGGGTGAGAACTAGGTTAGGGTCAGCATGGGGAGAGGGAAA
CAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 94650462..94650628 167
NO GENE  


Sequence tag IST14840D6HMR1
Sequence
ATATTAAAACAGAATCCTTAGTTTTGTGTCCCTTTGGACATATTGTCTTCCTATCACAAGCTTTGGTAAATCCCCCATTA
NTTTGGATTTCACATAGCTTTTGAATATATCTGACCACAGATGCTTACATTGTGCTGTATCGATCACTATTCTTACAACT
TTANCAATTATTTTGAAATAGGAAAAGAACAGCCACATTACCCTTTTTGAACATTTTAAAACTTAATATATTTTCTGTGG
AGTGCTTANAACTTGGGGTGTTTTNNCATCATGTAAGTGTATTTTCCAGACCATATTATATTGTTAGTTTCTAATAAGCC
CTTTGTACTTGTAATTAACCNAAAACCATGAANTTGCCTTGGAACTGTTTGTCATTTAAATAGCCTATTCATAATTCCCA
TTTCATGCTAAAGTTTAATGAACNAACACTTTTTGCTTANAATCNNNANNNGN
Sequence Type genomic DNA
Unitrap ID UNI30716

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17984746..17985189 426
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]


Sequence tag IST14840D6HMF2
Sequence
ATATTAATACATTTAGAAATGGTGACTACAGATTAGTAAAATGACATTTTTAGGAGGATATGGTAATAAATTTCTGGACC
TCTAATGATGCTCTTAACATAACTATGACTTGTACAAAGCTAGGGCAACTTTCAAACAGAAGTTTACTGTTTTAACTGTA
CCAAATATTTTACCTTTACCCTTATACAAAGGAAGTCAGTTCATTGTCTAAATCCTGTTTTGCCTCATAATATAGACTAA
TTTTGGTGCAAATCAATGTGGAACTTCCCAAACACTGAAGTCAAGCCTATGCACTAAATAATTTAAAAATACATTTCATT
TTATTTTTAATACATTGGAGCTTANTTCTTGAGATGGAACNNANTNGTATGAAAAAAAAGGGTNAGAATCTTACCTCATT
CTGTNNCACCTAATANATGTNNGTNAACANNNGCNNNTNNNANGACNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17984321..17984749 405
 
EST/CDNA Est Name
  BB275949.1 - BB269859.1 - BF536970.1

 
Come back to gene BB275949.1 - BB269859.1 - BF536970.1


For any suggestions or comments, please send an email to unitrap@crg.es